Amarengo

Articles and news

LCZ696, um Receptor da Angiotensina-Neprilysin Inibidor, Melhora a Hipertrofia Cardíaca e de Fibrose Cardíaca e Linfático Remodelação na Transversal da Aorta Constrição Modelo de Ratos

Resumo

hipertrofia e remodelamento ventricular seguinte insuficiência cardíaca são importantes causas da alta mortalidade em pacientes cardiopatas. O sistema linfático cardíaco tem sido associado a pesquisas limitadas, mas desempenha um papel importante na melhoria do edema miocárdico e na promoção do equilíbrio de fluidos. LCZ696 é uma nova combinação de inibidores da angiotensina e da neprilisina. Aqui, estudamos o papel desempenhado pelo LCZ696 durante a constrição aórtica transversa (TAC) induzida hipertrofia cardíaca e alterações no sistema linfático. Camundongos submetidos à coarctação aórtica foram construídos para representar um modelo de hipertrofia cardíaca e, em seguida, divididos em grupos aleatórios que receberam tratamento com LCZ696 (60 mg / kg / d) ou nenhum tratamento. A ultrassonografia cardíaca foi usada para detectar a função cardíaca, e hematoxilina e eosina (h&E) e coloração de Masson foram usadas para detectar hipertrofia miocárdica e fibrose. Os fatores pró-inflamatórios interleucina-6 (IL-6), IL-1β e fator de necrose tumoral-α (TNF-α) foram detectados no sangue e nos tecidos cardíacos de camundongos. Os níveis de expressão proteica de marcadores linfáticos específicos, como o Fator de crescimento endotelial vascular c (VEGF-C), O receptor VEGF 3 (VEGFR3) e o receptor de hialuronano endotelial do vaso linfático 1 (LYVE-1) foram detectados em tecidos cardíacos de camundongos. Também examinamos a colocalização de vasos linfáticos e macrófagos por imunofluorescência. Os resultados mostraram que o LCZ696 melhorou significativamente a disfunção cardíaca, a hipertrofia cardíaca e a fibrose e inibiu a expressão dos fatores pró-inflamatórios IL-6, IL-1β e TNF-α nos tecidos circulantes do sangue e do coração de camundongos. LCZ696 também diminuiu os níveis de expressão proteica de VEGF-C, VEGFR3 e LYVE-1 em tecidos cardíacos de camundongos, melhorou a carga de transporte de vasos linfáticos para macrófagos e melhorou a remodelação do sistema linfático no modelo de cardiomiopatia hipertrófica induzido por TAC.

1. Introdução

a insuficiência cardíaca continua sendo uma das principais causas de mortalidade e morbidade em todo o mundo, apesar de grandes melhorias nos tratamentos para doenças associadas. Estudos anteriores demonstraram que o LCZ696, que é um inibidor do receptor de angiotensina-neprilisina (ARNI), melhorou a função cardíaca, com a atenuação da fibrose, quando usado para tratar vários tipos de insuficiência cardíaca com frações de ejeção reduzidas . PARAMOUNT estudo (em uma perspectiva de comparação entre um ARNI e um bloqueador do receptor da angiotensina (ARB) para o tratamento da insuficiência cardíaca com fração de ejeção preservada (HFpEF)), LCZ696 tratamento reduziu os níveis séricos do N-terminal pro-B-tipo de peptídeo natriurético, em comparação com valsartan tratamento após 12 semanas, e foi bem tolerado quando utilizado para o tratamento de HFpEF . LCZ696 atenuou a remodelação Cardíaca e a disfunção após infarto do miocárdio (im), reduzindo a fibrose Cardíaca e a hipertrofia . Além disso, o tratamento com LCZ696 melhorou significativamente a hipertrofia cardíaca, a inflamação e a disfunção endotelial vascular em ratos hipertensos espontaneamente carregados de sal em comparação com o tratamento com valsartan . Além disso, o tratamento com LCZ696 inibiu a hipertrofia cardíaca, fibrose e vasculopatia em um modelo de rato de doença renal crônica . No entanto, o tratamento com LCZ696 melhorou a fibrose cardíaca induzida pelo isoproterenol, mas não a hipertrofia, em ratos . Os efeitos do LCZ696 na hipertrofia cardíaca induzida por sobrecarga de pressão permanecem obscuros, e os possíveis mecanismos potenciais são desconhecidos.

o coração possui uma extensa rede linfática que regula e mantém o equilíbrio de fluidos . O sistema linfático cardíaco tornou-se um alvo ativo para pesquisas, e avanços recentes neste campo forneceram novos insights sobre o tratamento de doenças cardiovasculares. O coração isquêmico exibe uma rede linfática disfuncional que participa do desenvolvimento de edema miocárdico crônico e agrava a disfunção cardíaca . A terapia linfangiogênica também foi usada com sucesso para resolver a formação de edema, acúmulo de células inflamatórias e fibrose em camundongos MI . No entanto, a linfangiogênese sustentada pode aumentar a exposição de alvos linfonodais, o que pode modular reações imunológicas adversas . Estudos em camundongos usando corações transplantados que carregam uma célula endotelial linfática- (LEC-) deleção específica do receptor 3 do fator de crescimento endotelial vascular (VEGFR3) confirmaram que a inibição do VEGFR3 leva à sobrevivência prolongada do aloenxerto cardíaco . Como o sistema linfático cardíaco muda durante a hipertrofia cardíaca induzida por sobrecarga de estresse e após a administração de LZC696 permanece desconhecido.

para lançar luz sobre os efeitos potenciais do LCZ696 na hipertrofia e fibrose em camundongos modelo de constrição aórtica transversa (TAC), aplicamos análises histológicas e quantitativas de reação em cadeia da polimerase (Q-PCR) para corações de camundongos modelo de hipertrofia de TAC. Através da medição dos níveis de VEGF-C, VEGFR3, e o vaso linfático endoteliais ácido hialurônico receptor 1 (LYVE-1), utilizando western blots, e examinando o colocalization dos vasos linfáticos e macrófagos, utilizando imunofluorescência, exploramos as mudanças que ocorreram na cardíaco, sistema linfático e o papel desempenhado pela LCZ696 no TAC ratos.

2. Materiais e métodos

2.1. Experimento Animal

camundongos adultos, machos, C57BL/6 (8-10 semanas de idade, 22-24 g) foram comprados no Laboratório de animais da Universidade Médica de Nanjing e alojados a 20-24°C, sob um ciclo claro-escuro de 12 h, no centro de animais de laboratório do Nanjing First Hospital. Alimentos e água estavam disponíveis gratuitamente durante todo o experimento. O protocolo do estudo foi aprovado pelos Comitês de Cuidados com animais do Laboratório Animal Centre & Nanjing First Hospital. Os ratos foram atribuídos aleatoriamente a um dos cinco grupos a seguir: sham, TAC 1 semana, Tac + LCZ696 1 semana, TAC 4 semanas e TAC + LCZ696 4 semanas. Conforme relatado anteriormente, o TAC foi realizado para estabelecer um modelo de hipertrofia cardíaca induzida por sobrecarga de pressão. Resumidamente, os camundongos C57BL / 6 foram anestesiados com 2,0% de isoflurano, colocados em uma placa cirúrgica aquecida e administrados por via subcutânea 2,5 mg/kg de flunixina. Em seguida, o tórax foi inserido e o arco aórtico foi isolado. O TAC foi realizado com uma sutura 6-0, que foi amarrada em torno de uma agulha de calibre 27 e do arco aórtico. Em seguida, a agulha foi removida para induzir 60% -80% de constrição da aorta. Uma operação cirúrgica simulada foi realizada para o grupo simulado, no qual a aorta transversa foi exposta, mas não foi contraída. A taxa de sobrevivência de camundongos após a cirurgia TAC foi de 68%. Para testar se o LCZ696 poderia inibir a hipertrofia cardíaca, tratamos os camundongos sobreviventes com solução salina (grupo sham, grupo TAC) ou LCZ696, a 60 mg/kg/dia (Grupo Tac + LCZ696), começando no segundo dia após a cirurgia. A dose de LCZ696 foi baseada em relatórios anteriores . Quatro semanas depois, após a realização das análises ecocardiográficas dos camundongos, todos os animais foram sacrificados e os tecidos cardíacos armazenados para estudos posteriores.

2.2. Ecocardiografia

as estruturas e funções cardíacas dos camundongos foram medidas usando o sistema Vevo2100 (Fujifilm Visual Sonics, Toronto, Canadá), com um transdutor MS‐400 de alta frequência (30 MHz), no centro Animal da Universidade Médica de Nanjing. Camundongos foram anestesiados por inalação de isoflurano antes da ultrassonografia cardíaca. A dose de indução de isoflurano foi de 3%, enquanto a dose de manutenção foi de 1.5%. As funções cardíacas de ratos foram avaliadas pela medição da dimensão interna do ventrículo esquerdo em sístole (LVIDS), dimensão interna do ventrículo esquerdo em diástole (LVIDD), sistólica ventricular esquerda posterior espessura de parede (LVPWS), diastólica do ventrículo esquerdo posterior espessura de parede (LVPWD), do septo interventricular final-espessura sistólica (IVSS), do septo interventricular final-espessura diastólica (IVSD), fração de ejeção ventricular esquerda (FE), curto-eixo fração (FS), e corrigido o índice de massa ventricular esquerda (LV Massa Corrigida).

2.3. Western Blots

Para medir os níveis de interleucina (IL)-6, IL-1β, fator de necrose tumoral-α (TNF-α), VEGF-C, VEGFR3, e LYVE-1, quantidades iguais de amostras foram carregados com 10% de dodecil sulfato de sódio (SDS)-géis de poliacrilamida. Em seguida, as proteínas resolvidas foram transferidas para uma membrana de Difluoreto de polivinilideno (PVDF) e incubadas por uma hora, à temperatura ambiente, em solução bloqueadora (5% de leite seco não gordo dissolvido em solução salina tamponada com solução tampão Tween 20). Em seguida, os filtros foram sondados, durante a noite, a 4°C, em solução de bloqueio contendo anticorpos primários, diluídos 1 : De 1.000, contra os seguintes: IL-6 (MB9296, Bioworld), IL-1β (BS6067, Bioworld), o TNF-α (11948S, Sinalização Celular Tecnologia), VEGF-C sc-374628, Santa Cruz Biotechnology), VEGFR3 (ab27278, Abcam), LYVE-1 (ab14917, Abcam), e β-actina (AP0060, Bioworld). As membranas foram lavadas duas vezes com tampão TBST e incubadas com anticorpo secundário conjugado com peroxidase de rábano (Tecnologia De Sinalização Celular), por 1 hora, à temperatura ambiente, seguido de lavagem três vezes. A detecção de sinal foi realizada usando um substrato de quimioluminescência aprimorado (Millipore, EUA) e quantificado usando o software Image J.

2.4. Análise quantitativa da Reação Em Cadeia da Transcriptase-polimerase reversa do RNA (qRT-PCR)

o RNA Total foi extraído do tecido cardíaco usando o reagente de TRIzol (Invitrogen, EUA). o cDNA foi produzido usando o kit de reagentes PrimeScript RT (Takara Biotechnology, China). o qRT-PCR foi realizado em um sistema ABI 7500 (Grand Island, NY, EUA), usando o Kit Sybr Premix Ex Taq (Takara Biotechnology, China). As condições de reação foram as seguintes: 95°C por 30 s para pré-saturação, seguido por 40 ciclos de 95°C por 5 s e 60°C por 34 s. Gliceraldeído 3-fosfato desidrogenase (GAPDH) foi usado como um gene de referência. Todos os primers usados estão listados na Tabela 1.

5′-3′ (sense) 5′-3′ (antisense)
GAPDH ACAGCAACAGGGTGGTGGAC TTTGAGGGTGCAGCGAACTT
ANP TGAGTGAGCAGACTGAGGAA TGGATCTTCGTAGGCTCCGA
BNP ACAGAAGCTGCTGGAGCTGA CCGATCCGGTCTATCTTGTG
Table 1
Sequence of the internal reference e os primers emparelhados.

2.5. Análise histológica

tecidos cardíacos isolados de camundongos foram fixados em formalina a 10%, durante a noite, à temperatura ambiente, desidratados por meio de concentrações crescentes de etanol e, em seguida, embutidos em parafina. Em seguida, as amostras foram cortadas em seções de 5 µm e coradas com hematoxilina e eosina (h&E) para analisar a morfologia cardíaca. As amostras também foram coradas com Tricromo de Masson para analisar a extensão da fibrose miocárdica . Os resultados foram observados usando um microscópio Olympus-BHS (San Jose, CA), anexado a uma câmera digital Qimaging Retiga 4000rv (Surrey, British Columbia, Canadá) e medido com o software Image J.

2.6. A coloração por imunofluorescência

secções congeladas do tecido cardíaco foram imunomarcadas, utilizando um marcador linfático (LYVE-1) e um marcador de macrófagos (CD68), para observar a linfangiogênese Cardíaca e a colocalização entre vasos linfáticos e macrófagos . O tecido foi fixado com paraformaldeído a 4%, por 20 minutos, à temperatura ambiente, depois permeabilizado com 0.5% Triton X-100 por 20 minutos. Após bloqueio com 5% de albumina sérica bovina (BSA), durante 1 hora, à temperatura ambiente, os tecidos foram incubados com um anticorpo LYVE-1 primário (ab14917, Abcam) e um anticorpo CD68 (ab53444, Abcam), a 4°C, durante a noite. 4 ‘ – 6-Diamidino-2-fenilindol (Dapi, Sigma) foi usado como um marcador nuclear. Finalmente, imagens fluorescentes foram obtidas usando um microscópio confocal a laser.

2.7. Expressão de Citocinas Pró-inflamatórias

Os níveis de expressão da pró-inflamatórias, fatores de IL-6, IL-1β e TNF-α no soro de ratinho foram detectados usando correspondente enzyme-linked immunosorbent assay (ELISA) kits (R&D Sistemas, Minnesota, MN, EUA).

2.8. Análise estatística

todos os dados foram analisados usando SPSS 22.0 (IBM Corporation, Armonk, EUA). Os dados são apresentados como média ± desvio padrão. O teste de Shapiro-Wilk foi utilizado para examinar a normalidade de todas as variáveis. Para dados normalmente distribuídos, um teste T de Student não pareado foi usado para comparações Binárias, enquanto uma análise de variância unidirecional (ANOVA) foi empregada para comparações múltiplas. Para distribuições Distorcidas de dados, as diferenças entre as variáveis foram analisadas usando o Wilcoxon signed-rank ou o teste de Friedman. foi considerado estatisticamente significativo.

3. Resultados

3.1. LCZ696 função cardíaca melhorada em camundongos modelo TAC

TAC foi aplicada para induzir hipertrofia cardíaca em camundongos, e o desenvolvimento de hipertrofia cardíaca e a regressão da hipertrofia cardíaca estabelecida foram confirmados por análises de ecocardiografia. Após a cirurgia, os camundongos TAC foram randomizados em um grupo que recebeu tratamento com LCZ696 (60 mg / kg) por 4 semanas ou um grupo que não recebeu tratamento. Como mostrado na Figura 1 (A), a função cardíaca foi significativamente prejudicada no grupo TAC sozinho, mas foi melhorada no grupo de tratamento LCZ696. Além disso, os indicadores de função cardíaca, como LVIDS, LVIDD, LVPWS, LVPWD, IVSS, IVSD, EF% e FS%, foram significativamente melhorados no grupo de tratamento LCZ696 em comparação com o grupo não tratado (Tabela 2). Diferenças significativas também foram observadas para o índice de massa ventricular esquerda entre esses grupos (Tabela 2).


(um)

(b)


(a)
b)

Figura 1
LCZ696 melhorado disfunção cardíaca no TAC ratos. (a) a ecocardiografia foi realizada em camundongos tratados com ou sem LCZ696, na dose indicada. (B) os níveis de expressão de mRNA de ANP e BNP foram medidos por RT-PCR. Os dados em (A) E (b) foram obtidos de seis camundongos em cada grupo. Todos os dados são expressos como a média ± DP. vs. sham; vs. TAC.

Os níveis de expressão do peptídeo natriurético atrial (ANP) e o peptídeo natriurético cerebral (BNP) do mRNA do ventrículo esquerdo, também foram examinados por q-PCR e foram significativamente aumentada no grupo TAC comparado com o grupo controle, mas diminuiu no LCZ696 grupo de tratamento, o que indicava que LCZ696 foi capaz de melhorar a insuficiência cardíaca induzida por pressão de sobrecarga (Figura 1(b)).

3.2. LCZ696 aliviou hipertrofia cardíaca e fibrose em camundongos TAC

conforme mostrado nas Figuras 2(a) e 2 (b), em comparação com o grupo sham, os ventrículos esquerdos no grupo TAC eram hipertróficos, com aumento das cavidades ventriculares esquerdas. Os cardiomiócitos foram aumentados no grupo TAC, com base na coloração h &E vista sob um objetivo 2x, enquanto o LCZ696 foi capaz de aliviar significativamente a hipertrofia cardíaca e melhorar a remodelação ventricular causada pelo TAC em camundongos (Figura 2(c)). A área transversal dos cardiomiócitos no grupo TAC também foi maior do que no grupo sham, mas foi menor no grupo LCZ696, com base na coloração h&E vista sob um objetivo de 40x (Figura 2(d)). Esses resultados indicaram ainda que o tratamento com LCZ696 foi capaz de inibir a hipertrofia cardíaca e melhorar a remodelação ventricular.

Figura 2
LCZ696 inibido de hipertrofia cardíaca e de fibrose. (a) as morfologias dos corações dos ratos, da esquerda para a direita: grupo sham, grupo Tac, grupo Tac + LCZ696. (b) a relação entre o peso do coração e o peso corporal (HW/BW). (c, d) as morfologias cardíacas e cardiomiócitos foram analisados por hematoxilina e eosina (h&e) coloração, separadamente, e examinado sob 20x e 400x ampliação. (e) a fibrose cardíaca foi medida por coloração Tricrômica de Masson e examinada sob ampliação de 200x. Os dados em(A)–(e) foram obtidos de seis camundongos em cada grupo. Todos os dados são expressos como a média ± DP. vs. sham; vs. TAC.

hipertrofia e apoptose cardiomiocitária resultaram na deposição de fibras de colágeno e fibrose do coração. Como mostrado na Figura 2(e), as fibras de colágeno foram coradas de azul por coloração de Masson e a fibrose miocárdica no grupo TAC foi significativamente aumentada em comparação com a do grupo sham, mas diminuiu no grupo de tratamento LCZ696. Esses resultados demonstraram que o tratamento com LCZ696 poderia inibir a fibrose induzida pela sobrecarga de pressão.

3.3. O tratamento com LCZ696 inibiu a resposta inflamatória em camundongos TAC

a resposta inflamatória é um fator importante na aceleração do desenvolvimento de insuficiência cardíaca crônica. Para entender melhor as mudanças na expressão de fatores inflamatórios que ocorrem em camundongos TAC e os efeitos do tratamento com LCZ696 no momento dessas mudanças, também examinamos camundongos TAC após 1 semana, com ou sem tratamento com LCZ696. Como mostrado na Figura 3 (a), os níveis de expressão dos fatores pró-inflamatórios IL-6, IL-1β e TNF-α no sangue circulante de camundongos TAC após 1 semana foram apenas ligeiramente aumentados em comparação com os do grupo sham, enquanto esses níveis foram significativamente aumentados em camundongos TAC após 4 semanas. A administração de LCZ696 por 1 semana e 4 semanas foi capaz de reduzir os níveis de expressão de fatores pró-inflamatórios em comparação com os respectivos grupos TAC. Este resultado é consistente com os níveis de expressão proteica observados para fatores pró-inflamatórios nos tecidos cardíacos de camundongos (Figura 3(b)).


(um)

(b)


(a)
b)

Figura 3
LCZ696 inibe a expressão de pró-inflamatórias, fatores da circulação de sangue e de coração tecidos. (a) os níveis de expressão dos fatores pró-inflamatórios IL-6, IL-1β e TNF-α no sangue circulante de camundongos foram medidos por ensaio de imunoabsorção enzimática. (b) os níveis de expressão proteica de IL-6, IL-1β e TNF-α nos tecidos cardíacos de camundongos foram detectados por manchas ocidentais. Os dados em (A) foram obtidos de seis camundongos em cada grupo. Os dados em (b) foram obtidos de quatro camundongos em cada grupo. Todos os dados são expressos como a média ± DP. vs. sham; vs. TAC 1W; vs. TAC 4W. 1W indica 1 semana, 4W indica 4 semanas.

3.4. O tratamento com LCZ696 reduziu as cargas de transporte de vasos linfáticos para macrófagos e melhorou a remodelação do sistema linfático em camundongos TAC

linfangiogênese miocárdica foi observada durante insuficiência cardíaca no modelo de IM. Para explorar o potencial mecanismo através do qual o tratamento com LCZ696 melhora a hipertrofia miocárdica, avaliamos ainda mais a linfangiogênese miocárdica, detectando a expressão de fatores reguladores e marcadores linfáticos. Os níveis de expressão de VEGF-C, VEGFR3 e LYVE-1 foram detectados pelo Western blot. Como mostrado na Figura 4, a expressão da proteína níveis de VEGF-C, VEGFR3, e LYVE-1, no coração de tecidos de ratos começou a aumentar na primeira semana após o TAC cirurgia, sugerindo um aumento na linfangiogênese, e chegou a um nível superior, pela quarta semana após a cirurgia; no entanto, esses níveis foram diminuídas pela administração com LCZ696 para 1 e 4 semanas. Além disso, a coloração por imunofluorescência para LYVE-1 e CD68 mostrou que o número de vasos linfáticos aumentou em camundongos 1 semana após o TAC, acompanhado pela agregação de macrófagos ao redor dos vasos linfáticos (Figura 5). Esse fenômeno foi ainda mais óbvio 4 semanas após o TAC. No entanto, o número de vasos linfáticos nos tecidos cardíacos de camundongos tratados com LCZ696 por 1 semana e 4 semanas foi reduzido em comparação com os grupos TAC correspondentes, e o acúmulo observado de macrófagos ao redor dos vasos linfáticos também foi reduzido.

Figura 4
LCZ696 alterou a expressão de linfática marcadores endoteliais. Os níveis de expressão proteica de VEGF-C, VEGFR3 e LYVE-1 foram determinados por Western blot. Os dados foram obtidos de quatro camundongos em cada grupo. Todos os dados são expressos como a média ± DP. vs. sham; vs. TAC 1W; vs. TAC 4W. 1W indica 1 semana, 4W indica 4 semanas.

Figura 5
LCZ696 melhorou a remodelação do sistema linfático e a acumulação de macrófagos CD68 no mouse coração tecidos, tal como avaliado por imunofluorescência, sob ampliação de 400x. Os dados foram obtidos de quatro camundongos em cada grupo. 1W indica 1 semana, 4W indica 4 semanas.

4. Discussão

em nosso estudo, a coarctação aórtica causou o aumento da expressão de fatores pró-inflamatórios nos tecidos circulantes de sangue e coração de camundongos e aumento da linfangiogênese e acúmulo de macrófagos próximos aos vasos linfáticos. Esses efeitos foram significativamente melhorados pelo tratamento com LCZ696, independentemente do tempo de tratamento. Além disso, edema cardíaco, fibrose e disfunção também melhoraram em camundongos TAC tratados com LCZ696. Portanto, explorar os mecanismos potenciais através dos quais o tratamento com LCZ696 melhora os sintomas do TAC pode ter implicações clínicas importantes.

a inflamação, seguida de fibrose, é uma importante característica patológica da hipertrofia patológica . Em nossos experimentos, o aumento observado nos níveis de expressão do fator pró-inflamatório tanto no sangue quanto nos tecidos cardíacos de camundongos TAC e o acúmulo de macrófagos demonstraram que a resposta inflamatória é ativa no modelo TAC. No entanto, o tratamento com LCZ696 foi capaz de inibir significativamente a resposta inflamatória induzida pelo TAC, o que é consistente com nossos achados anteriores em um modelo de cardiomiopatia diabética . Todos esses dados sugeriram que o tratamento com LCZ696 suprime a inflamação, que é um potencial gatilho da fibrose cardíaca.

LCZ696, uma combinação do bloqueador do receptor da angiotensina II valsartan e do inibidor da neprilisina sacubitril, demonstrou melhorar as funções cardíacas em estudos anteriores; no entanto, os mecanismos subjacentes pelos quais os atos LCZ696 permanecem obscuros. LCZ696 foi relatado para melhorar a função cardíaca, com a atenuação da fibrose, através da via de sinalização do fator de crescimento transformador-β (TGF-β) em um modelo de camundongo diabético induzido por estreptozotocina de insuficiência cardíaca com fração de ejeção reduzida . von Lueder relatou que o LCZ696 atenuou a remodelação Cardíaca e a disfunção após o IM, reduzindo a fibrose Cardíaca e a hipertrofia . Além disso, o LCZ696 demonstrou melhorar a função cardíaca, aliviando a disfunção mitocondrial mediada pela proteína 1-(Drp1 -) relacionada à dinamina em um modelo de camundongo de cardiomiopatia dilatada induzida por doxorrubicina . Em nosso estudo, descobrimos que a hipertrofia cardíaca e a fibrose miocárdica foram significativamente inibidas em camundongos TAC pelo tratamento com LCZ696. LCZ696 melhorou ainda mais a hipertrofia cardíaca neste modelo TAC, que representa outro tipo de insuficiência cardíaca.

o coração possui uma ampla rede linfática que regula o equilíbrio de fluidos no tecido intersticial, e a disfunção do sistema linfático pode levar ao edema miocárdico. Muitas doenças cardiovasculares, como MI e insuficiência cardíaca crônica, têm sido associadas ao edema miocárdico. Durante o edema miocárdico, muitas citocinas inflamatórias são expressas e são gerados radicais livres de oxigênio, que têm efeitos negativos na função linfática, levando à displasia do fluxo linfático, linfedema e inflamação crônica . Nosso estudo sugeriu que os efeitos inibitórios do tratamento LCZ696 na remodelação do vaso linfático cardíaco induzida por TAC podem ser atribuídos à inibição da expressão inflamatória de citocinas, que por sua vez, reduziu a carga de transporte linfático para as células imunes. Linfático marcadores endoteliais, como VEGFR3, LYVE-1, podoplanin, e Prox-1, foram confirmados para desempenhar papéis-chave no desenvolvimento do sistema linfático e tem sido amplamente utilizado para a detecção de linfangiogênese e vaso linfático invasão . Em nosso estudo, o número de vasos linfáticos marcados com LYVE-1 miocárdico e macrófagos CD68 começou a aumentar uma semana após o TAC e continuou a aumentar quatro semanas após o TAC; no entanto, ambos foram reduzidos pelo tratamento com LCZ696. Além disso, as alterações nos níveis de expressão proteica observadas para VEGF-C, VEGFR3 e LYVE-1 em tecidos cardíacos de camundongos, conforme medido por manchas ocidentais, foram consistentes com os resultados da imunofluorescência. O edema miocárdico, estimulado por fatores inflamatórios durante a hipertrofia cardíaca, pode levar à displasia do fluxo linfático, gênese linfática anormal e ao aumento da expressão de LYVE-1. O tratamento com LCZ696 foi capaz de inibir a expressão de fatores inflamatórios e reduzir o grau de edema miocárdico, que pode estar relacionado à redução da linfangiogênese e diminuição da expressão de LYVE-1.

um estudo recente mostrou que a estimulação seletiva da linfangiogênese cardíaca pode melhorar a disfunção cardíaca causada pelo IM agudo . No entanto, o aumento dos vasos linfáticos causado pelo IM agudo foi composto principalmente por vasos linfáticos capilares, com diâmetros inferiores a 5 µm, que não têm efeitos de transporte, enquanto o número de vasos linfáticos coletores com função de transporte foi reduzido. Portanto, para entender melhor os impactos do tratamento LCZ696 no sistema linfático no modelo TAC, mais pesquisas são necessárias para distinguir mudanças nos vasos linfáticos capilares das mudanças na coleta de vasos linfáticos. Curiosamente, outro estudo relatou que a inibição da linfangiogênese pelo inibidor de VEGFR3 SAR131675 melhorou a função renal em um modelo de camundongo diabético tipo 2 . Se os efeitos dos agonistas ou inibidores do VEGFR3 no sistema linfático são devidos a alterações nos números, funções de transporte ou conformações dos vasos linfáticos permanece desconhecido. Portanto, se o tratamento com LCZ696 tem efeitos diretos no sistema linfático, como é observado para agonistas ou inibidores de VEGFR3, requer uma exploração adicional. O uso de agonistas ou inibidores de VEGFR3 ainda não foi relatado no modelo TAC. No futuro, realizaremos mais pesquisas nesta área para explorar o papel desempenhado pela linfa no sistema cardiovascular e examinar possíveis novas estratégias terapêuticas para o tratamento da insuficiência cardíaca.

5. Conclusões

o tratamento com LCZ696 melhorou a hipertrofia cardíaca, a fibrose e a remodelação linfática cardíaca, inibindo a resposta inflamatória em camundongos modelo TAC.

disponibilidade de dados

os dados utilizados para apoiar os achados deste estudo estão disponíveis do autor correspondente mediante solicitação.

divulgação

Qing Ge e Li Zhao são co-primeiros autores.

conflitos de interesse

os autores declaram que não têm conflitos de interesse.

contribuições dos autores

Qing Ge e Li Zhao contribuíram igualmente para este estudo.

agradecimentos

os autores agradecem a Lisa Giles, PhD, de Liwen Bianji, Edanz Editing, China (http://www.liwenbianji.cn/ac), por editar o texto Em inglês de um rascunho deste manuscrito. Este trabalho foi apoiado pelo projeto-chave e pela Medical Science and Technology Development Foundation, Departamento de saúde de Nanjing (número de concessão AKX18032).

Deixe uma resposta

O seu endereço de email não será publicado.